ID: 937427397

View in Genome Browser
Species Human (GRCh38)
Location 2:121811820-121811842
Sequence CCAAGGCTTGGGACTTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937427397_937427412 28 Left 937427397 2:121811820-121811842 CCTTGCAAAGTCCCAAGCCTTGG No data
Right 937427412 2:121811871-121811893 CCCTTTGTGGGTCTGGCCTTGGG No data
937427397_937427406 16 Left 937427397 2:121811820-121811842 CCTTGCAAAGTCCCAAGCCTTGG No data
Right 937427406 2:121811859-121811881 GCTACCCTTACACCCTTTGTGGG No data
937427397_937427402 -7 Left 937427397 2:121811820-121811842 CCTTGCAAAGTCCCAAGCCTTGG No data
Right 937427402 2:121811836-121811858 GCCTTGGAGGCATCTTTGTTAGG No data
937427397_937427405 15 Left 937427397 2:121811820-121811842 CCTTGCAAAGTCCCAAGCCTTGG No data
Right 937427405 2:121811858-121811880 GGCTACCCTTACACCCTTTGTGG No data
937427397_937427404 -6 Left 937427397 2:121811820-121811842 CCTTGCAAAGTCCCAAGCCTTGG No data
Right 937427404 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
937427397_937427409 21 Left 937427397 2:121811820-121811842 CCTTGCAAAGTCCCAAGCCTTGG No data
Right 937427409 2:121811864-121811886 CCTTACACCCTTTGTGGGTCTGG No data
937427397_937427410 27 Left 937427397 2:121811820-121811842 CCTTGCAAAGTCCCAAGCCTTGG No data
Right 937427410 2:121811870-121811892 ACCCTTTGTGGGTCTGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937427397 Original CRISPR CCAAGGCTTGGGACTTTGCA AGG (reversed) Intergenic