ID: 937427403

View in Genome Browser
Species Human (GRCh38)
Location 2:121811837-121811859
Sequence CCCTAACAAAGATGCCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937427403_937427415 24 Left 937427403 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
Right 937427415 2:121811884-121811906 TGGCCTTGGGACCATGGCCTTGG No data
937427403_937427406 -1 Left 937427403 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
Right 937427406 2:121811859-121811881 GCTACCCTTACACCCTTTGTGGG No data
937427403_937427412 11 Left 937427403 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
Right 937427412 2:121811871-121811893 CCCTTTGTGGGTCTGGCCTTGGG No data
937427403_937427405 -2 Left 937427403 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
Right 937427405 2:121811858-121811880 GGCTACCCTTACACCCTTTGTGG No data
937427403_937427414 18 Left 937427403 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
Right 937427414 2:121811878-121811900 TGGGTCTGGCCTTGGGACCATGG No data
937427403_937427409 4 Left 937427403 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
Right 937427409 2:121811864-121811886 CCTTACACCCTTTGTGGGTCTGG No data
937427403_937427410 10 Left 937427403 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
Right 937427410 2:121811870-121811892 ACCCTTTGTGGGTCTGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937427403 Original CRISPR CCCTAACAAAGATGCCTCCA AGG (reversed) Intergenic