ID: 937427405

View in Genome Browser
Species Human (GRCh38)
Location 2:121811858-121811880
Sequence GGCTACCCTTACACCCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937427401_937427405 3 Left 937427401 2:121811832-121811854 CCAAGCCTTGGAGGCATCTTTGT No data
Right 937427405 2:121811858-121811880 GGCTACCCTTACACCCTTTGTGG No data
937427403_937427405 -2 Left 937427403 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
Right 937427405 2:121811858-121811880 GGCTACCCTTACACCCTTTGTGG No data
937427396_937427405 26 Left 937427396 2:121811809-121811831 CCTAAGAAAGACCTTGCAAAGTC No data
Right 937427405 2:121811858-121811880 GGCTACCCTTACACCCTTTGTGG No data
937427400_937427405 4 Left 937427400 2:121811831-121811853 CCCAAGCCTTGGAGGCATCTTTG No data
Right 937427405 2:121811858-121811880 GGCTACCCTTACACCCTTTGTGG No data
937427397_937427405 15 Left 937427397 2:121811820-121811842 CCTTGCAAAGTCCCAAGCCTTGG No data
Right 937427405 2:121811858-121811880 GGCTACCCTTACACCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937427405 Original CRISPR GGCTACCCTTACACCCTTTG TGG Intergenic