ID: 937427406

View in Genome Browser
Species Human (GRCh38)
Location 2:121811859-121811881
Sequence GCTACCCTTACACCCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937427396_937427406 27 Left 937427396 2:121811809-121811831 CCTAAGAAAGACCTTGCAAAGTC No data
Right 937427406 2:121811859-121811881 GCTACCCTTACACCCTTTGTGGG No data
937427403_937427406 -1 Left 937427403 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
Right 937427406 2:121811859-121811881 GCTACCCTTACACCCTTTGTGGG No data
937427397_937427406 16 Left 937427397 2:121811820-121811842 CCTTGCAAAGTCCCAAGCCTTGG No data
Right 937427406 2:121811859-121811881 GCTACCCTTACACCCTTTGTGGG No data
937427401_937427406 4 Left 937427401 2:121811832-121811854 CCAAGCCTTGGAGGCATCTTTGT No data
Right 937427406 2:121811859-121811881 GCTACCCTTACACCCTTTGTGGG No data
937427400_937427406 5 Left 937427400 2:121811831-121811853 CCCAAGCCTTGGAGGCATCTTTG No data
Right 937427406 2:121811859-121811881 GCTACCCTTACACCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937427406 Original CRISPR GCTACCCTTACACCCTTTGT GGG Intergenic