ID: 937427409

View in Genome Browser
Species Human (GRCh38)
Location 2:121811864-121811886
Sequence CCTTACACCCTTTGTGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937427397_937427409 21 Left 937427397 2:121811820-121811842 CCTTGCAAAGTCCCAAGCCTTGG No data
Right 937427409 2:121811864-121811886 CCTTACACCCTTTGTGGGTCTGG No data
937427403_937427409 4 Left 937427403 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
Right 937427409 2:121811864-121811886 CCTTACACCCTTTGTGGGTCTGG No data
937427400_937427409 10 Left 937427400 2:121811831-121811853 CCCAAGCCTTGGAGGCATCTTTG No data
Right 937427409 2:121811864-121811886 CCTTACACCCTTTGTGGGTCTGG No data
937427401_937427409 9 Left 937427401 2:121811832-121811854 CCAAGCCTTGGAGGCATCTTTGT No data
Right 937427409 2:121811864-121811886 CCTTACACCCTTTGTGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937427409 Original CRISPR CCTTACACCCTTTGTGGGTC TGG Intergenic