ID: 937427414

View in Genome Browser
Species Human (GRCh38)
Location 2:121811878-121811900
Sequence TGGGTCTGGCCTTGGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937427403_937427414 18 Left 937427403 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
Right 937427414 2:121811878-121811900 TGGGTCTGGCCTTGGGACCATGG No data
937427401_937427414 23 Left 937427401 2:121811832-121811854 CCAAGCCTTGGAGGCATCTTTGT No data
Right 937427414 2:121811878-121811900 TGGGTCTGGCCTTGGGACCATGG No data
937427407_937427414 -8 Left 937427407 2:121811863-121811885 CCCTTACACCCTTTGTGGGTCTG No data
Right 937427414 2:121811878-121811900 TGGGTCTGGCCTTGGGACCATGG No data
937427400_937427414 24 Left 937427400 2:121811831-121811853 CCCAAGCCTTGGAGGCATCTTTG No data
Right 937427414 2:121811878-121811900 TGGGTCTGGCCTTGGGACCATGG No data
937427408_937427414 -9 Left 937427408 2:121811864-121811886 CCTTACACCCTTTGTGGGTCTGG No data
Right 937427414 2:121811878-121811900 TGGGTCTGGCCTTGGGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937427414 Original CRISPR TGGGTCTGGCCTTGGGACCA TGG Intergenic