ID: 937427415

View in Genome Browser
Species Human (GRCh38)
Location 2:121811884-121811906
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937427403_937427415 24 Left 937427403 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
Right 937427415 2:121811884-121811906 TGGCCTTGGGACCATGGCCTTGG No data
937427400_937427415 30 Left 937427400 2:121811831-121811853 CCCAAGCCTTGGAGGCATCTTTG 0: 1
1: 1
2: 11
3: 55
4: 460
Right 937427415 2:121811884-121811906 TGGCCTTGGGACCATGGCCTTGG No data
937427407_937427415 -2 Left 937427407 2:121811863-121811885 CCCTTACACCCTTTGTGGGTCTG No data
Right 937427415 2:121811884-121811906 TGGCCTTGGGACCATGGCCTTGG No data
937427401_937427415 29 Left 937427401 2:121811832-121811854 CCAAGCCTTGGAGGCATCTTTGT No data
Right 937427415 2:121811884-121811906 TGGCCTTGGGACCATGGCCTTGG No data
937427411_937427415 -10 Left 937427411 2:121811871-121811893 CCCTTTGTGGGTCTGGCCTTGGG No data
Right 937427415 2:121811884-121811906 TGGCCTTGGGACCATGGCCTTGG No data
937427408_937427415 -3 Left 937427408 2:121811864-121811886 CCTTACACCCTTTGTGGGTCTGG No data
Right 937427415 2:121811884-121811906 TGGCCTTGGGACCATGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type