ID: 937437751

View in Genome Browser
Species Human (GRCh38)
Location 2:121893241-121893263
Sequence AGACGGGCCCAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937437751_937437760 9 Left 937437751 2:121893241-121893263 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 937437760 2:121893273-121893295 GCCCAACAGCTCACTGAGAACGG 0: 10
1: 441
2: 1147
3: 351
4: 213
937437751_937437764 15 Left 937437751 2:121893241-121893263 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 937437764 2:121893279-121893301 CAGCTCACTGAGAACGGGCCAGG 0: 9
1: 417
2: 88
3: 15
4: 129
937437751_937437766 26 Left 937437751 2:121893241-121893263 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 937437766 2:121893290-121893312 GAACGGGCCAGGATGACAATGGG 0: 2
1: 0
2: 4
3: 7
4: 72
937437751_937437768 28 Left 937437751 2:121893241-121893263 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 937437768 2:121893292-121893314 ACGGGCCAGGATGACAATGGGGG 0: 344
1: 728
2: 777
3: 340
4: 190
937437751_937437767 27 Left 937437751 2:121893241-121893263 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 937437767 2:121893291-121893313 AACGGGCCAGGATGACAATGGGG 0: 2
1: 1
2: 5
3: 9
4: 83
937437751_937437765 25 Left 937437751 2:121893241-121893263 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 937437765 2:121893289-121893311 AGAACGGGCCAGGATGACAATGG 0: 368
1: 806
2: 723
3: 375
4: 374
937437751_937437762 10 Left 937437751 2:121893241-121893263 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 937437762 2:121893274-121893296 CCCAACAGCTCACTGAGAACGGG 0: 44
1: 1416
2: 531
3: 140
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937437751 Original CRISPR AGACGGGCCCAGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr