ID: 937439513

View in Genome Browser
Species Human (GRCh38)
Location 2:121904249-121904271
Sequence AGAAAACTGAGACTCAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937439513_937439520 28 Left 937439513 2:121904249-121904271 CCTCTGTTGAGTCTCAGTTTTCT No data
Right 937439520 2:121904300-121904322 CTCACTGCACAGGATCAAGCTGG No data
937439513_937439516 -7 Left 937439513 2:121904249-121904271 CCTCTGTTGAGTCTCAGTTTTCT No data
Right 937439516 2:121904265-121904287 GTTTTCTCTTCCAGAAAATGGGG No data
937439513_937439514 -9 Left 937439513 2:121904249-121904271 CCTCTGTTGAGTCTCAGTTTTCT No data
Right 937439514 2:121904263-121904285 CAGTTTTCTCTTCCAGAAAATGG No data
937439513_937439515 -8 Left 937439513 2:121904249-121904271 CCTCTGTTGAGTCTCAGTTTTCT No data
Right 937439515 2:121904264-121904286 AGTTTTCTCTTCCAGAAAATGGG No data
937439513_937439518 4 Left 937439513 2:121904249-121904271 CCTCTGTTGAGTCTCAGTTTTCT No data
Right 937439518 2:121904276-121904298 CAGAAAATGGGGATGTTAACAGG No data
937439513_937439519 18 Left 937439513 2:121904249-121904271 CCTCTGTTGAGTCTCAGTTTTCT No data
Right 937439519 2:121904290-121904312 GTTAACAGGACTCACTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937439513 Original CRISPR AGAAAACTGAGACTCAACAG AGG (reversed) Intergenic
No off target data available for this crispr