ID: 937439518

View in Genome Browser
Species Human (GRCh38)
Location 2:121904276-121904298
Sequence CAGAAAATGGGGATGTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937439513_937439518 4 Left 937439513 2:121904249-121904271 CCTCTGTTGAGTCTCAGTTTTCT No data
Right 937439518 2:121904276-121904298 CAGAAAATGGGGATGTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937439518 Original CRISPR CAGAAAATGGGGATGTTAAC AGG Intergenic
No off target data available for this crispr