ID: 937445387

View in Genome Browser
Species Human (GRCh38)
Location 2:121952995-121953017
Sequence GGATGCAGCTCTGCTGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937445382_937445387 -1 Left 937445382 2:121952973-121952995 CCTGGAGGCATCCTTAGGCCCAG No data
Right 937445387 2:121952995-121953017 GGATGCAGCTCTGCTGCAACAGG No data
937445377_937445387 17 Left 937445377 2:121952955-121952977 CCATCCATAGACAAGGAGCCTGG No data
Right 937445387 2:121952995-121953017 GGATGCAGCTCTGCTGCAACAGG No data
937445380_937445387 13 Left 937445380 2:121952959-121952981 CCATAGACAAGGAGCCTGGAGGC No data
Right 937445387 2:121952995-121953017 GGATGCAGCTCTGCTGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937445387 Original CRISPR GGATGCAGCTCTGCTGCAAC AGG Intergenic
No off target data available for this crispr