ID: 937448676

View in Genome Browser
Species Human (GRCh38)
Location 2:121981760-121981782
Sequence CACTGCGACCTCTGCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937448672_937448676 19 Left 937448672 2:121981718-121981740 CCCTCTGTCGCCAGGGTGGACTG No data
Right 937448676 2:121981760-121981782 CACTGCGACCTCTGCCTCCCAGG No data
937448673_937448676 18 Left 937448673 2:121981719-121981741 CCTCTGTCGCCAGGGTGGACTGC No data
Right 937448676 2:121981760-121981782 CACTGCGACCTCTGCCTCCCAGG No data
937448675_937448676 9 Left 937448675 2:121981728-121981750 CCAGGGTGGACTGCAGTGGCGTG No data
Right 937448676 2:121981760-121981782 CACTGCGACCTCTGCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937448676 Original CRISPR CACTGCGACCTCTGCCTCCC AGG Intergenic