ID: 937458209

View in Genome Browser
Species Human (GRCh38)
Location 2:122062370-122062392
Sequence GCAGCTAGGGAGAGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937458209_937458217 19 Left 937458209 2:122062370-122062392 CCTGCCTCACTCTCCCTAGCTGC No data
Right 937458217 2:122062412-122062434 ATGCATCACCACCTGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937458209 Original CRISPR GCAGCTAGGGAGAGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr