ID: 937459044

View in Genome Browser
Species Human (GRCh38)
Location 2:122069798-122069820
Sequence GGCGAATGGCCTGGCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937459044_937459052 12 Left 937459044 2:122069798-122069820 CCAGCCCAGCCAGGCCATTCGCC No data
Right 937459052 2:122069833-122069855 TTCAGCCTCCTCTGCAAAGGTGG No data
937459044_937459053 13 Left 937459044 2:122069798-122069820 CCAGCCCAGCCAGGCCATTCGCC No data
Right 937459053 2:122069834-122069856 TCAGCCTCCTCTGCAAAGGTGGG No data
937459044_937459051 9 Left 937459044 2:122069798-122069820 CCAGCCCAGCCAGGCCATTCGCC No data
Right 937459051 2:122069830-122069852 ATGTTCAGCCTCCTCTGCAAAGG No data
937459044_937459054 16 Left 937459044 2:122069798-122069820 CCAGCCCAGCCAGGCCATTCGCC No data
Right 937459054 2:122069837-122069859 GCCTCCTCTGCAAAGGTGGGTGG No data
937459044_937459057 23 Left 937459044 2:122069798-122069820 CCAGCCCAGCCAGGCCATTCGCC No data
Right 937459057 2:122069844-122069866 CTGCAAAGGTGGGTGGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937459044 Original CRISPR GGCGAATGGCCTGGCTGGGC TGG (reversed) Intergenic
No off target data available for this crispr