ID: 937465891

View in Genome Browser
Species Human (GRCh38)
Location 2:122132729-122132751
Sequence TTGAGTGTGCTTTAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937465886_937465891 15 Left 937465886 2:122132691-122132713 CCCAGGACAAACTCAAGGGCAGG No data
Right 937465891 2:122132729-122132751 TTGAGTGTGCTTTAAGTGGAAGG No data
937465888_937465891 14 Left 937465888 2:122132692-122132714 CCAGGACAAACTCAAGGGCAGGT No data
Right 937465891 2:122132729-122132751 TTGAGTGTGCTTTAAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937465891 Original CRISPR TTGAGTGTGCTTTAAGTGGA AGG Intergenic
No off target data available for this crispr