ID: 937467584

View in Genome Browser
Species Human (GRCh38)
Location 2:122148221-122148243
Sequence CTAACTCAACTTGGACTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937467584_937467586 -3 Left 937467584 2:122148221-122148243 CCATGGAGTCCAAGTTGAGTTAG No data
Right 937467586 2:122148241-122148263 TAGTAAATGAAGAAAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937467584 Original CRISPR CTAACTCAACTTGGACTCCA TGG (reversed) Intergenic
No off target data available for this crispr