ID: 937468822

View in Genome Browser
Species Human (GRCh38)
Location 2:122157921-122157943
Sequence ACCAACAAGCCCAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937468822_937468830 19 Left 937468822 2:122157921-122157943 CCTTCCTCATTGGGCTTGTTGGT No data
Right 937468830 2:122157963-122157985 CTGAACACAGGGTGTCTTCTTGG No data
937468822_937468832 27 Left 937468822 2:122157921-122157943 CCTTCCTCATTGGGCTTGTTGGT No data
Right 937468832 2:122157971-122157993 AGGGTGTCTTCTTGGGAATGAGG No data
937468822_937468825 7 Left 937468822 2:122157921-122157943 CCTTCCTCATTGGGCTTGTTGGT No data
Right 937468825 2:122157951-122157973 GACACAGAGCCCCTGAACACAGG No data
937468822_937468826 8 Left 937468822 2:122157921-122157943 CCTTCCTCATTGGGCTTGTTGGT No data
Right 937468826 2:122157952-122157974 ACACAGAGCCCCTGAACACAGGG No data
937468822_937468831 20 Left 937468822 2:122157921-122157943 CCTTCCTCATTGGGCTTGTTGGT No data
Right 937468831 2:122157964-122157986 TGAACACAGGGTGTCTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937468822 Original CRISPR ACCAACAAGCCCAATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr