ID: 937469289

View in Genome Browser
Species Human (GRCh38)
Location 2:122161471-122161493
Sequence GCCACTTAGAAAAAAACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937469289_937469296 30 Left 937469289 2:122161471-122161493 CCATGTGTTTTTTTCTAAGTGGC No data
Right 937469296 2:122161524-122161546 TGCCTTAAACCAAGGAGGTCAGG No data
937469289_937469294 22 Left 937469289 2:122161471-122161493 CCATGTGTTTTTTTCTAAGTGGC No data
Right 937469294 2:122161516-122161538 GGACTTACTGCCTTAAACCAAGG No data
937469289_937469290 -3 Left 937469289 2:122161471-122161493 CCATGTGTTTTTTTCTAAGTGGC No data
Right 937469290 2:122161491-122161513 GGCCTTGCCTTAGAACGCAGAGG No data
937469289_937469295 25 Left 937469289 2:122161471-122161493 CCATGTGTTTTTTTCTAAGTGGC No data
Right 937469295 2:122161519-122161541 CTTACTGCCTTAAACCAAGGAGG No data
937469289_937469292 1 Left 937469289 2:122161471-122161493 CCATGTGTTTTTTTCTAAGTGGC No data
Right 937469292 2:122161495-122161517 TTGCCTTAGAACGCAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937469289 Original CRISPR GCCACTTAGAAAAAAACACA TGG (reversed) Intergenic
No off target data available for this crispr