ID: 937472260

View in Genome Browser
Species Human (GRCh38)
Location 2:122184274-122184296
Sequence GTTTATTTAAGGTCACCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937472260_937472265 16 Left 937472260 2:122184274-122184296 CCATTAGGTGACCTTAAATAAAC No data
Right 937472265 2:122184313-122184335 TAGTTTCCTAATATAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937472260 Original CRISPR GTTTATTTAAGGTCACCTAA TGG (reversed) Intergenic
No off target data available for this crispr