ID: 937475388

View in Genome Browser
Species Human (GRCh38)
Location 2:122210370-122210392
Sequence CAGGAGATGGACCCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937475382_937475388 2 Left 937475382 2:122210345-122210367 CCAGTCCCCACTGATAATTCACT No data
Right 937475388 2:122210370-122210392 CAGGAGATGGACCCTGCTGCTGG No data
937475383_937475388 -3 Left 937475383 2:122210350-122210372 CCCCACTGATAATTCACTTGCAG No data
Right 937475388 2:122210370-122210392 CAGGAGATGGACCCTGCTGCTGG No data
937475386_937475388 -5 Left 937475386 2:122210352-122210374 CCACTGATAATTCACTTGCAGGA No data
Right 937475388 2:122210370-122210392 CAGGAGATGGACCCTGCTGCTGG No data
937475384_937475388 -4 Left 937475384 2:122210351-122210373 CCCACTGATAATTCACTTGCAGG No data
Right 937475388 2:122210370-122210392 CAGGAGATGGACCCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937475388 Original CRISPR CAGGAGATGGACCCTGCTGC TGG Intergenic
No off target data available for this crispr