ID: 937481211

View in Genome Browser
Species Human (GRCh38)
Location 2:122261481-122261503
Sequence ACTCCATCTCTGCTGCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937481209_937481211 -5 Left 937481209 2:122261463-122261485 CCAGCTGCCAGGTTTCAAACTCC No data
Right 937481211 2:122261481-122261503 ACTCCATCTCTGCTGCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937481211 Original CRISPR ACTCCATCTCTGCTGCTGAC TGG Intergenic
No off target data available for this crispr