ID: 937482622

View in Genome Browser
Species Human (GRCh38)
Location 2:122278029-122278051
Sequence CATTGGAGTTTCCCCTCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937482622_937482628 0 Left 937482622 2:122278029-122278051 CCCGTGGAGGGGAAACTCCAATG No data
Right 937482628 2:122278052-122278074 CCAAACCCTTTAGGCACTTAGGG No data
937482622_937482626 -1 Left 937482622 2:122278029-122278051 CCCGTGGAGGGGAAACTCCAATG No data
Right 937482626 2:122278051-122278073 GCCAAACCCTTTAGGCACTTAGG No data
937482622_937482624 -9 Left 937482622 2:122278029-122278051 CCCGTGGAGGGGAAACTCCAATG No data
Right 937482624 2:122278043-122278065 ACTCCAATGCCAAACCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937482622 Original CRISPR CATTGGAGTTTCCCCTCCAC GGG (reversed) Intergenic