ID: 937482623

View in Genome Browser
Species Human (GRCh38)
Location 2:122278030-122278052
Sequence GCATTGGAGTTTCCCCTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937482623_937482624 -10 Left 937482623 2:122278030-122278052 CCGTGGAGGGGAAACTCCAATGC No data
Right 937482624 2:122278043-122278065 ACTCCAATGCCAAACCCTTTAGG No data
937482623_937482626 -2 Left 937482623 2:122278030-122278052 CCGTGGAGGGGAAACTCCAATGC No data
Right 937482626 2:122278051-122278073 GCCAAACCCTTTAGGCACTTAGG No data
937482623_937482628 -1 Left 937482623 2:122278030-122278052 CCGTGGAGGGGAAACTCCAATGC No data
Right 937482628 2:122278052-122278074 CCAAACCCTTTAGGCACTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937482623 Original CRISPR GCATTGGAGTTTCCCCTCCA CGG (reversed) Intergenic