ID: 937482624

View in Genome Browser
Species Human (GRCh38)
Location 2:122278043-122278065
Sequence ACTCCAATGCCAAACCCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937482622_937482624 -9 Left 937482622 2:122278029-122278051 CCCGTGGAGGGGAAACTCCAATG No data
Right 937482624 2:122278043-122278065 ACTCCAATGCCAAACCCTTTAGG No data
937482621_937482624 -8 Left 937482621 2:122278028-122278050 CCCCGTGGAGGGGAAACTCCAAT No data
Right 937482624 2:122278043-122278065 ACTCCAATGCCAAACCCTTTAGG No data
937482623_937482624 -10 Left 937482623 2:122278030-122278052 CCGTGGAGGGGAAACTCCAATGC No data
Right 937482624 2:122278043-122278065 ACTCCAATGCCAAACCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937482624 Original CRISPR ACTCCAATGCCAAACCCTTT AGG Intergenic