ID: 937482626

View in Genome Browser
Species Human (GRCh38)
Location 2:122278051-122278073
Sequence GCCAAACCCTTTAGGCACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937482621_937482626 0 Left 937482621 2:122278028-122278050 CCCCGTGGAGGGGAAACTCCAAT No data
Right 937482626 2:122278051-122278073 GCCAAACCCTTTAGGCACTTAGG No data
937482622_937482626 -1 Left 937482622 2:122278029-122278051 CCCGTGGAGGGGAAACTCCAATG No data
Right 937482626 2:122278051-122278073 GCCAAACCCTTTAGGCACTTAGG No data
937482623_937482626 -2 Left 937482623 2:122278030-122278052 CCGTGGAGGGGAAACTCCAATGC No data
Right 937482626 2:122278051-122278073 GCCAAACCCTTTAGGCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937482626 Original CRISPR GCCAAACCCTTTAGGCACTT AGG Intergenic