ID: 937484112

View in Genome Browser
Species Human (GRCh38)
Location 2:122295927-122295949
Sequence CTTTGAATAAGTAAGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937484112_937484115 4 Left 937484112 2:122295927-122295949 CCACCTGCCTTACTTATTCAAAG No data
Right 937484115 2:122295954-122295976 GAGTCACCTGCCTTCTTCAAAGG No data
937484112_937484120 23 Left 937484112 2:122295927-122295949 CCACCTGCCTTACTTATTCAAAG No data
Right 937484120 2:122295973-122295995 AAGGGTTCTCAAAGTAGAGTGGG No data
937484112_937484119 22 Left 937484112 2:122295927-122295949 CCACCTGCCTTACTTATTCAAAG No data
Right 937484119 2:122295972-122295994 AAAGGGTTCTCAAAGTAGAGTGG No data
937484112_937484116 5 Left 937484112 2:122295927-122295949 CCACCTGCCTTACTTATTCAAAG No data
Right 937484116 2:122295955-122295977 AGTCACCTGCCTTCTTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937484112 Original CRISPR CTTTGAATAAGTAAGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr