ID: 937485193

View in Genome Browser
Species Human (GRCh38)
Location 2:122308377-122308399
Sequence AAGAGCAGCAGGTGTGACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937485193_937485200 1 Left 937485193 2:122308377-122308399 CCCTTGTCACACCTGCTGCTCTT No data
Right 937485200 2:122308401-122308423 TCGGCTGAGGACAAGGGACAAGG No data
937485193_937485198 -6 Left 937485193 2:122308377-122308399 CCCTTGTCACACCTGCTGCTCTT No data
Right 937485198 2:122308394-122308416 GCTCTTCTCGGCTGAGGACAAGG No data
937485193_937485202 27 Left 937485193 2:122308377-122308399 CCCTTGTCACACCTGCTGCTCTT No data
Right 937485202 2:122308427-122308449 TCTCTGGCCACAGTTGCCCTTGG No data
937485193_937485201 11 Left 937485193 2:122308377-122308399 CCCTTGTCACACCTGCTGCTCTT No data
Right 937485201 2:122308411-122308433 ACAAGGGACAAGGTTGTCTCTGG No data
937485193_937485199 -5 Left 937485193 2:122308377-122308399 CCCTTGTCACACCTGCTGCTCTT No data
Right 937485199 2:122308395-122308417 CTCTTCTCGGCTGAGGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937485193 Original CRISPR AAGAGCAGCAGGTGTGACAA GGG (reversed) Intergenic
No off target data available for this crispr