ID: 937485196

View in Genome Browser
Species Human (GRCh38)
Location 2:122308388-122308410
Sequence CCTCAGCCGAGAAGAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937485196_937485205 24 Left 937485196 2:122308388-122308410 CCTGCTGCTCTTCTCGGCTGAGG No data
Right 937485205 2:122308435-122308457 CACAGTTGCCCTTGGACAGGTGG No data
937485196_937485200 -10 Left 937485196 2:122308388-122308410 CCTGCTGCTCTTCTCGGCTGAGG No data
Right 937485200 2:122308401-122308423 TCGGCTGAGGACAAGGGACAAGG No data
937485196_937485202 16 Left 937485196 2:122308388-122308410 CCTGCTGCTCTTCTCGGCTGAGG No data
Right 937485202 2:122308427-122308449 TCTCTGGCCACAGTTGCCCTTGG No data
937485196_937485206 25 Left 937485196 2:122308388-122308410 CCTGCTGCTCTTCTCGGCTGAGG No data
Right 937485206 2:122308436-122308458 ACAGTTGCCCTTGGACAGGTGGG No data
937485196_937485201 0 Left 937485196 2:122308388-122308410 CCTGCTGCTCTTCTCGGCTGAGG No data
Right 937485201 2:122308411-122308433 ACAAGGGACAAGGTTGTCTCTGG No data
937485196_937485203 21 Left 937485196 2:122308388-122308410 CCTGCTGCTCTTCTCGGCTGAGG No data
Right 937485203 2:122308432-122308454 GGCCACAGTTGCCCTTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937485196 Original CRISPR CCTCAGCCGAGAAGAGCAGC AGG (reversed) Intergenic
No off target data available for this crispr