ID: 937485200

View in Genome Browser
Species Human (GRCh38)
Location 2:122308401-122308423
Sequence TCGGCTGAGGACAAGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937485192_937485200 11 Left 937485192 2:122308367-122308389 CCATTAACTACCCTTGTCACACC No data
Right 937485200 2:122308401-122308423 TCGGCTGAGGACAAGGGACAAGG No data
937485196_937485200 -10 Left 937485196 2:122308388-122308410 CCTGCTGCTCTTCTCGGCTGAGG No data
Right 937485200 2:122308401-122308423 TCGGCTGAGGACAAGGGACAAGG No data
937485193_937485200 1 Left 937485193 2:122308377-122308399 CCCTTGTCACACCTGCTGCTCTT No data
Right 937485200 2:122308401-122308423 TCGGCTGAGGACAAGGGACAAGG No data
937485194_937485200 0 Left 937485194 2:122308378-122308400 CCTTGTCACACCTGCTGCTCTTC No data
Right 937485200 2:122308401-122308423 TCGGCTGAGGACAAGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937485200 Original CRISPR TCGGCTGAGGACAAGGGACA AGG Intergenic
No off target data available for this crispr