ID: 937485202

View in Genome Browser
Species Human (GRCh38)
Location 2:122308427-122308449
Sequence TCTCTGGCCACAGTTGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937485193_937485202 27 Left 937485193 2:122308377-122308399 CCCTTGTCACACCTGCTGCTCTT No data
Right 937485202 2:122308427-122308449 TCTCTGGCCACAGTTGCCCTTGG No data
937485194_937485202 26 Left 937485194 2:122308378-122308400 CCTTGTCACACCTGCTGCTCTTC No data
Right 937485202 2:122308427-122308449 TCTCTGGCCACAGTTGCCCTTGG No data
937485196_937485202 16 Left 937485196 2:122308388-122308410 CCTGCTGCTCTTCTCGGCTGAGG No data
Right 937485202 2:122308427-122308449 TCTCTGGCCACAGTTGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937485202 Original CRISPR TCTCTGGCCACAGTTGCCCT TGG Intergenic
No off target data available for this crispr