ID: 937485203

View in Genome Browser
Species Human (GRCh38)
Location 2:122308432-122308454
Sequence GGCCACAGTTGCCCTTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937485196_937485203 21 Left 937485196 2:122308388-122308410 CCTGCTGCTCTTCTCGGCTGAGG No data
Right 937485203 2:122308432-122308454 GGCCACAGTTGCCCTTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937485203 Original CRISPR GGCCACAGTTGCCCTTGGAC AGG Intergenic
No off target data available for this crispr