ID: 937491931

View in Genome Browser
Species Human (GRCh38)
Location 2:122378738-122378760
Sequence ACTGCTCCTTTCCCATTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937491931_937491933 4 Left 937491931 2:122378738-122378760 CCATCAAATGGGAAAGGAGCAGT No data
Right 937491933 2:122378765-122378787 TGAATAGGCTTTAACTGCCTTGG No data
937491931_937491935 25 Left 937491931 2:122378738-122378760 CCATCAAATGGGAAAGGAGCAGT No data
Right 937491935 2:122378786-122378808 GGCTTCCTATGCCTCCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937491931 Original CRISPR ACTGCTCCTTTCCCATTTGA TGG (reversed) Intergenic
No off target data available for this crispr