ID: 937492106

View in Genome Browser
Species Human (GRCh38)
Location 2:122380632-122380654
Sequence GACGGTGTTCTATAAGATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937492100_937492106 23 Left 937492100 2:122380586-122380608 CCTTTTCTCTTGCCTGTTATAAC No data
Right 937492106 2:122380632-122380654 GACGGTGTTCTATAAGATAGAGG No data
937492103_937492106 11 Left 937492103 2:122380598-122380620 CCTGTTATAACAATAGAGGAGGC No data
Right 937492106 2:122380632-122380654 GACGGTGTTCTATAAGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937492106 Original CRISPR GACGGTGTTCTATAAGATAG AGG Intergenic
No off target data available for this crispr