ID: 937493293

View in Genome Browser
Species Human (GRCh38)
Location 2:122392387-122392409
Sequence GCTTTGAAGGGGATTATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937493281_937493293 13 Left 937493281 2:122392351-122392373 CCTCAAATCCATCTTCCCAAGGA No data
Right 937493293 2:122392387-122392409 GCTTTGAAGGGGATTATGGAGGG No data
937493287_937493293 -3 Left 937493287 2:122392367-122392389 CCAAGGAGTTCTGAGCTGGGGCT No data
Right 937493293 2:122392387-122392409 GCTTTGAAGGGGATTATGGAGGG No data
937493279_937493293 14 Left 937493279 2:122392350-122392372 CCCTCAAATCCATCTTCCCAAGG No data
Right 937493293 2:122392387-122392409 GCTTTGAAGGGGATTATGGAGGG No data
937493286_937493293 -2 Left 937493286 2:122392366-122392388 CCCAAGGAGTTCTGAGCTGGGGC No data
Right 937493293 2:122392387-122392409 GCTTTGAAGGGGATTATGGAGGG No data
937493282_937493293 5 Left 937493282 2:122392359-122392381 CCATCTTCCCAAGGAGTTCTGAG No data
Right 937493293 2:122392387-122392409 GCTTTGAAGGGGATTATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937493293 Original CRISPR GCTTTGAAGGGGATTATGGA GGG Intergenic
No off target data available for this crispr