ID: 937494495

View in Genome Browser
Species Human (GRCh38)
Location 2:122403312-122403334
Sequence TTACTCCAGCGGTTCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937494495_937494501 20 Left 937494495 2:122403312-122403334 CCCACTGAGAACCGCTGGAGTAA No data
Right 937494501 2:122403355-122403377 GAGTCCATTAGTAAAAATAATGG No data
937494495_937494503 28 Left 937494495 2:122403312-122403334 CCCACTGAGAACCGCTGGAGTAA No data
Right 937494503 2:122403363-122403385 TAGTAAAAATAATGGAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937494495 Original CRISPR TTACTCCAGCGGTTCTCAGT GGG (reversed) Intergenic
No off target data available for this crispr