ID: 937494618

View in Genome Browser
Species Human (GRCh38)
Location 2:122404677-122404699
Sequence CAGGATAAGTAGATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937494618_937494622 11 Left 937494618 2:122404677-122404699 CCTTGCTCCATCTACTTATCCTG No data
Right 937494622 2:122404711-122404733 ACTAATCAAATAGATTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937494618 Original CRISPR CAGGATAAGTAGATGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr