ID: 937496565

View in Genome Browser
Species Human (GRCh38)
Location 2:122426410-122426432
Sequence CTGTGTCCTCACAGGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937496565_937496568 -2 Left 937496565 2:122426410-122426432 CCTTCTTGCCTGTGAGGACACAG No data
Right 937496568 2:122426431-122426453 AGCAAGAGGAGCCATCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937496565 Original CRISPR CTGTGTCCTCACAGGCAAGA AGG (reversed) Intergenic
No off target data available for this crispr