ID: 937496713

View in Genome Browser
Species Human (GRCh38)
Location 2:122428206-122428228
Sequence GTGTGGAAGGTGGAGTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937496713_937496718 -8 Left 937496713 2:122428206-122428228 CCCAGCAACTCCACCTTCCACAC No data
Right 937496718 2:122428221-122428243 TTCCACACTGCCCCCCAGTAGGG No data
937496713_937496717 -9 Left 937496713 2:122428206-122428228 CCCAGCAACTCCACCTTCCACAC No data
Right 937496717 2:122428220-122428242 CTTCCACACTGCCCCCCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937496713 Original CRISPR GTGTGGAAGGTGGAGTTGCT GGG (reversed) Intergenic
No off target data available for this crispr