ID: 937496713 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:122428206-122428228 |
Sequence | GTGTGGAAGGTGGAGTTGCT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937496713_937496718 | -8 | Left | 937496713 | 2:122428206-122428228 | CCCAGCAACTCCACCTTCCACAC | No data | ||
Right | 937496718 | 2:122428221-122428243 | TTCCACACTGCCCCCCAGTAGGG | No data | ||||
937496713_937496717 | -9 | Left | 937496713 | 2:122428206-122428228 | CCCAGCAACTCCACCTTCCACAC | No data | ||
Right | 937496717 | 2:122428220-122428242 | CTTCCACACTGCCCCCCAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937496713 | Original CRISPR | GTGTGGAAGGTGGAGTTGCT GGG (reversed) | Intergenic | ||
No off target data available for this crispr |