ID: 937500337

View in Genome Browser
Species Human (GRCh38)
Location 2:122471608-122471630
Sequence CCACATTTTCAACTGTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937500337_937500339 -2 Left 937500337 2:122471608-122471630 CCAGGAAACAGTTGAAAATGTGG No data
Right 937500339 2:122471629-122471651 GGAATTGAATGTCATAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937500337 Original CRISPR CCACATTTTCAACTGTTTCC TGG (reversed) Intergenic
No off target data available for this crispr