ID: 937504254

View in Genome Browser
Species Human (GRCh38)
Location 2:122518618-122518640
Sequence TACTGGCTCCTTCTGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937504254_937504259 12 Left 937504254 2:122518618-122518640 CCTGCCTTCAGAAGGAGCCAGTA No data
Right 937504259 2:122518653-122518675 GGGACCAATGTTCTCAATAGAGG No data
937504254_937504257 -8 Left 937504254 2:122518618-122518640 CCTGCCTTCAGAAGGAGCCAGTA No data
Right 937504257 2:122518633-122518655 AGCCAGTAGTTCTTGCAGAAGGG No data
937504254_937504260 13 Left 937504254 2:122518618-122518640 CCTGCCTTCAGAAGGAGCCAGTA No data
Right 937504260 2:122518654-122518676 GGACCAATGTTCTCAATAGAGGG No data
937504254_937504256 -9 Left 937504254 2:122518618-122518640 CCTGCCTTCAGAAGGAGCCAGTA No data
Right 937504256 2:122518632-122518654 GAGCCAGTAGTTCTTGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937504254 Original CRISPR TACTGGCTCCTTCTGAAGGC AGG (reversed) Intergenic
No off target data available for this crispr