ID: 937505011

View in Genome Browser
Species Human (GRCh38)
Location 2:122527067-122527089
Sequence TAGGTTAGTTAGGAAGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937505011_937505013 -5 Left 937505011 2:122527067-122527089 CCAGTATCTTCCTAACTAACCTA No data
Right 937505013 2:122527085-122527107 ACCTAAGTCTTTTAATTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937505011 Original CRISPR TAGGTTAGTTAGGAAGATAC TGG (reversed) Intergenic
No off target data available for this crispr