ID: 937521625

View in Genome Browser
Species Human (GRCh38)
Location 2:122719981-122720003
Sequence TCATTGTCCAAGCAAAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937521623_937521625 14 Left 937521623 2:122719944-122719966 CCAGATAATGTAAAAACCTGCTA No data
Right 937521625 2:122719981-122720003 TCATTGTCCAAGCAAAATAAAGG No data
937521624_937521625 -2 Left 937521624 2:122719960-122719982 CCTGCTACTAATAGACGTCAGTC No data
Right 937521625 2:122719981-122720003 TCATTGTCCAAGCAAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937521625 Original CRISPR TCATTGTCCAAGCAAAATAA AGG Intergenic
No off target data available for this crispr