ID: 937529303

View in Genome Browser
Species Human (GRCh38)
Location 2:122808962-122808984
Sequence TGGGGGTCCTAGAACTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937529303_937529304 -9 Left 937529303 2:122808962-122808984 CCTTGGGAGTTCTAGGACCCCCA No data
Right 937529304 2:122808976-122808998 GGACCCCCAACCCCCACCACTGG No data
937529303_937529316 26 Left 937529303 2:122808962-122808984 CCTTGGGAGTTCTAGGACCCCCA No data
Right 937529316 2:122809011-122809033 CTACTACAGCTGATACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937529303 Original CRISPR TGGGGGTCCTAGAACTCCCA AGG (reversed) Intergenic
No off target data available for this crispr