ID: 937530420

View in Genome Browser
Species Human (GRCh38)
Location 2:122820692-122820714
Sequence GATTAAAGCAGATGAACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937530417_937530420 6 Left 937530417 2:122820663-122820685 CCATGGAGGGAATGAACCTCATT No data
Right 937530420 2:122820692-122820714 GATTAAAGCAGATGAACTGCAGG No data
937530418_937530420 -10 Left 937530418 2:122820679-122820701 CCTCATTTACCATGATTAAAGCA No data
Right 937530420 2:122820692-122820714 GATTAAAGCAGATGAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937530420 Original CRISPR GATTAAAGCAGATGAACTGC AGG Intergenic
No off target data available for this crispr