ID: 937531189

View in Genome Browser
Species Human (GRCh38)
Location 2:122829577-122829599
Sequence ATTTATCTGCAGAGGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937531189_937531193 14 Left 937531189 2:122829577-122829599 CCTGCCATCCTCTGCAGATAAAT No data
Right 937531193 2:122829614-122829636 AAACAGCTTTACCCTGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937531189 Original CRISPR ATTTATCTGCAGAGGATGGC AGG (reversed) Intergenic
No off target data available for this crispr