ID: 937536531

View in Genome Browser
Species Human (GRCh38)
Location 2:122895722-122895744
Sequence CCCTAGAGTTGATTCAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937536531_937536536 23 Left 937536531 2:122895722-122895744 CCACCATTGAATCAACTCTAGGG No data
Right 937536536 2:122895768-122895790 ACTCATGTCCTGCAACTGGATGG No data
937536531_937536535 19 Left 937536531 2:122895722-122895744 CCACCATTGAATCAACTCTAGGG No data
Right 937536535 2:122895764-122895786 AGGCACTCATGTCCTGCAACTGG No data
937536531_937536534 -1 Left 937536531 2:122895722-122895744 CCACCATTGAATCAACTCTAGGG No data
Right 937536534 2:122895744-122895766 GTAACAGTTAGACAGTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937536531 Original CRISPR CCCTAGAGTTGATTCAATGG TGG (reversed) Intergenic
No off target data available for this crispr