ID: 937536534

View in Genome Browser
Species Human (GRCh38)
Location 2:122895744-122895766
Sequence GTAACAGTTAGACAGTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937536533_937536534 -4 Left 937536533 2:122895725-122895747 CCATTGAATCAACTCTAGGGTAA No data
Right 937536534 2:122895744-122895766 GTAACAGTTAGACAGTTTAAAGG No data
937536531_937536534 -1 Left 937536531 2:122895722-122895744 CCACCATTGAATCAACTCTAGGG No data
Right 937536534 2:122895744-122895766 GTAACAGTTAGACAGTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937536534 Original CRISPR GTAACAGTTAGACAGTTTAA AGG Intergenic
No off target data available for this crispr