ID: 937536535

View in Genome Browser
Species Human (GRCh38)
Location 2:122895764-122895786
Sequence AGGCACTCATGTCCTGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937536533_937536535 16 Left 937536533 2:122895725-122895747 CCATTGAATCAACTCTAGGGTAA No data
Right 937536535 2:122895764-122895786 AGGCACTCATGTCCTGCAACTGG No data
937536531_937536535 19 Left 937536531 2:122895722-122895744 CCACCATTGAATCAACTCTAGGG No data
Right 937536535 2:122895764-122895786 AGGCACTCATGTCCTGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937536535 Original CRISPR AGGCACTCATGTCCTGCAAC TGG Intergenic
No off target data available for this crispr