ID: 937536536

View in Genome Browser
Species Human (GRCh38)
Location 2:122895768-122895790
Sequence ACTCATGTCCTGCAACTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937536531_937536536 23 Left 937536531 2:122895722-122895744 CCACCATTGAATCAACTCTAGGG No data
Right 937536536 2:122895768-122895790 ACTCATGTCCTGCAACTGGATGG No data
937536533_937536536 20 Left 937536533 2:122895725-122895747 CCATTGAATCAACTCTAGGGTAA No data
Right 937536536 2:122895768-122895790 ACTCATGTCCTGCAACTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937536536 Original CRISPR ACTCATGTCCTGCAACTGGA TGG Intergenic
No off target data available for this crispr