ID: 937536632

View in Genome Browser
Species Human (GRCh38)
Location 2:122896801-122896823
Sequence AACAAGATGGAGTAGTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937536629_937536632 18 Left 937536629 2:122896760-122896782 CCTGTTAAGAGAGCAAGTGAAAT No data
Right 937536632 2:122896801-122896823 AACAAGATGGAGTAGTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937536632 Original CRISPR AACAAGATGGAGTAGTAGTC AGG Intergenic
No off target data available for this crispr